How social network has bad effect on people Essay

How social network has bad effect on people - Essay Example positive advantages, social media does have a number of drawbacks on individuals and society alike and it is important for these drawbacks to be analyzed so as to better understand how these negative drawbacks can be avoided. Although the use of social media has been noted to have a positive effect on our social lives as it enables us to easily keep in-touch with each other, of note however is that a number of negative effects are associated with it; social media is thought to cause it to be difficult for individuals to distinguish the positive and meaningful relationships that they are able to foster in the real world, and the myriad of causal relationships that they form through social media. We now tend to focus more n the less meaningful social media connections at the expense of the meaningful real life connections that we have made. Although social media has positively impacted our social lives as it has served to provide increased intimacy between friends, this attribute is also being widely used by predators that practice cyber bullying. The devastation that is wrought by online attacks can have the effect of leaving victims with deep emotional scars and as illustrated by a number of well-publici zed cases, cyber-bullying has at times resulted in victims being driven to committing suicide (Ryan and Cooper, 115). Social media has also been noted to have an impact in our social lives as constantly knowing where one’s friends are going, what they are doing or seeing can be deemed as being voyeuristic. If not careful, users can end up comparing themselves to their friends and in the process generating feelings of inadequacy. If they are not engaged in a process whereby they are doing something as exiting or great, they might start feeling worthless as their self esteem gradually becomes dented (Szalay et al. 285). If not careful, users can attempt to try and counteract this by making up stories and in the process find themselves trapped in an ever expanding

Balanced Diet Essay Example for Free

Balanced Diet Essay Maintaining a healthy balanced diet is important for maintaining optimal health throughout life. For women of childbearing age, good nutrition is important for preparing the body for the demands of pregnancy. During pregnancy, a woman’s macronutrient (energy) and micronutrient (e.g. vitamins, mineral) requirements increase, and it is even more important that she consumes food which will give her both the energy and the specific micronutrients which are essential for maintaining her and her growing baby’s health. For example, women require an additional 240 calories of energy per day in the second trimester and 452 calories per day in the third trimester of pregnancy to account for foetal growth. An additional 975 milligrams of iron is required in the course of the pregnancy to form foetal and additional maternal blood. While nutritional supplements can provide large quantities of particular micronutrients, a healthy balanced diet should form the basis of a woman’s nutritional intake. Good nutrition is most important immediately prior to conception and during the first 12 weeks of pregnancy (including the very early stages, when the woman is unaware she is pregnant). It is therefore important for women to maintain a healthy diet throughout their childbearing years, and particularly if they are planning to become pregnant.In addition to regular exercise, a healthy well balanced diet is essential for good health. Life or rather the quality of life you have is dependent on having good health. A well balanced diet would contain the three main groups of food as well as important vitamins and minerals. The first group of carbohydrates are found in foods such as bread, potatoes and rice. They are essentially energy giving foods which power the muscles and other tissues in our body. The next class of food is the proteins which form the solid part in all living cells. They are commonly found in milk, met and fish, and are necessary for the body to build new cells and repair old damaged ones. For this very reason growing children require a greater intake of the different kinds of proteins as compared to adults. Lastly we have fats which are also energy-living foods but do not give it up as quickly as carbohydrates because their molecular structure is designed to render them ideal as storage foods. As children are much more active than adults they use up more energy for their size and therefore require more energy giving foods such as  carbohydrates. To this end fats are unsuitable. Moreover too much of a fatty food intake at an early age may lead to a problem with obesity in later life. In adults fatty deposits on the walls of the blood vessels in the form of cholesterol may lead to all kinds of heart ailments. In addition to the foods above the body also needs small quantities of protective substances called vitamins and minerals. They are normally present in a sensible diet. For example vitamins A and D are found in some fatty foods. Vitamin D is important along with the mineral calcium, found in milk, for the formation of bones. Vitamin B is found in the husks of wheat or rice ad vitamin C in fresh fruits such as oranges and lemons. Important minerals such as potassium, zinc and iron are present in traces n most foods too. In addition to regular exercise, a healthy well balanced diet is essential for good health. Life or rather the quality of life you have is dependent on having good health. A well balanced diet would contain the three main groups of food as well as important vitamins and minerals. The first group of carbohydrates are found in foods such as bread, potatoes and rice. They are essentially energy giving foods which power the muscles and other tissues in our body. The next class of food is the proteins which form the solid part in all living cells. They are commonly found in milk, met and fish, and are necessary for the body to build new cells and repair old damaged ones. For this very reason growing children require a greater intake of the different kinds of proteins as compared to adults. Lastly we have fats which are also energy-living foods but do not give it up as quickly as carbohydrates because their molecular structure is designed to render them ideal as storage foods. As children are much more active than adults they use up more energy for their size and therefore require more energy giving foods such as carbohydrates. To this end fats are unsuitable. Moreover too much of a fatty food intake at an early age may lead to a problem with obesity in later life. In adults fatty deposits on the walls of the blood vessels in the form of cholesterol may lead to all kinds of heart ailments. In addition to the foods above the body also needs small quantities of protective substances called vitamins and minerals. They are normally present in a sensible diet. For example vitamins A and D are found in some fatty foods. Vitamin D is important along with the mineral calcium, found in milk, for the formation of bones. Vitamin B is found in the husks of wheat or rice ad vitamin C in fresh fruits such as oranges and lemons. Important minerals such as potassium, zinc and iron are present in traces n most foods too. In addition to regular exercise, a healthy well balanced diet is essential for good health. Life or rather the quality of life you have is dependent on having good health. A well balanced diet would contain the three main groups of food as well as important vitamins and minerals. The first group of carbohydrates are found in foods such as bread, potatoes and rice. They are essentially energy giving foods which power the muscles and other tissues in our body. The next class of food is the proteins which form the solid part in all living cells. They are commonly found in milk, met and fish, and are necessary for the body to build new cells and repair old damaged ones. For this very reason growing children require a greater intake of the different kinds of proteins as compared to adults. Lastly we have fats which are also energy-living foods but do not give it up as quickly as carbohydrates because their molecular structure is designed to render them ideal as storage foods. As children are much more active than adults they use up more energy for their size and therefore require more energy giving foods such as carbohydrates. To this end fats are unsuitable. Moreover too much of a fatty food intake at an early age may lead to a problem with obesity in later life. In adults fatty deposits on the walls of the blood vessels in the form of cholesterol may lead to all kinds of heart ailments. In addition to the foods above the body also needs small quantities of protective substances called vitamins and minerals. They are normally present in a sensible diet. For example vitamins A and D are found in some fatty foods. Vitamin D is important along with the mineral  calcium, found in milk, for the formation of bones. Vitamin B is found in the husks of wheat or rice ad vitamin C in fresh fruits such as oranges and lemons. Important minerals such as potassium, zinc and iron are present in traces n most foods too. In addition to regular exercise, a healthy well balanced diet is essential for good health. Life or rather the quality of life you have is dependent on having good health. A well balanced diet would contain the three main groups of food as well as important vitamins and minerals. The first group of carbohydrates are found in foods such as bread, potatoes and rice. They are essentially energy giving foods which power the muscles and other tissues in our body. The next class of food is the proteins which form the solid part in all living cells. They are commonly found in milk, met and fish, and are necessary for the body to build new cells and repair old damaged ones. For this very reason growing children require a greater intake of the different kinds of proteins as compared to adults. Lastly we have fats which are also energy-living foods but do not give it up as quickly as carbohydrates because their molecular structure is designed to render them ideal as storage foods. As children are much more active than adults they use up more energy for their size and therefore require more energy giving foods such as carbohydrates. To this end fats are unsuitable. Moreover too much of a fatty food intake at an early age may lead to a problem with obesity in later life. In adults fatty deposits on the walls of the blood vessels in the form of cholesterol may lead to all kinds of heart ailments. In addition to the foods above the body also needs small quantities of protective substances called vitamins and minerals. They are normally present in a sensible diet. For example vitamins A and D are found in some fatty foods. Vitamin D is important along with the mineral calcium, found in milk, for the formation of bones. Vitamin B is found in the husks of wheat or rice ad vitamin C in fresh fruits such as oranges and lemons. Important minerals such as potassium, zinc and iron are present in traces n most foods too. In addition to regular exercise, a healthy well balanced diet is essential for good health. Life or rather the quality of  life you have is dependent on having good health. A well balanced diet would contain the three main groups of food as well as important vitamins and minerals. The first group of carbohydrates are found in foods such as bread, potatoes and rice. They are essentially energy giving foods which power the muscles and other tissues in our body. The next class of food is the proteins which form the solid part in all living cells. They are commonly found in milk, met and fish, and are necessary for the body to build new cells and repair old damaged ones. For this very reason growing children require a greater intake of the different kinds of proteins as compared to adults. Lastly we have fats which are also energy-living foods but do not give it up as quickly as carbohydrates because their molecular structure is designed to render them ideal as storage foods. As children are much more active than adults they use up more energy for their size and therefore require more energy giving foods such as carbohydrates. To this end fats are unsuitable. Moreover too much of a fatty food intake at an early age may lead to a problem with obesity in later life. In adults fatty deposits on the walls of the blood vessels in the form of cholesterol may lead to all kinds of heart ailments. In addition to the foods above the body also needs small quantities of protective substances called vitamins and minerals. They are normally present in a sensible diet. For example vitamins A and D are found in some fatty foods. Vitamin D is important along with the mineral calcium, found in milk, for the formation of bones. Vitamin B is found in the husks of wheat or rice ad vitamin C in fresh fruits such as oranges and lemons. Important minerals such as potassium, zinc and iron are present in traces n most foods too.

pipe lines :: essays research papers

Herkansingsopdracht ETGRS2 (interactieve lesbrief): Als herkansing wordt van een student gevraagd een lesbrief over een onderwerp of thema uit het vakgebied van Game Technologie / Game Design uit te werken als een zelfstandig te ‘lezen’ lesbrief. Doel is je, op basis van het geen in de lessen is behandeld, je eigen interesse, vaardigheid en richting, verdieping te zoeken in een thema / onderwerp, en dit zodanig te presenteren in een lesbrief dat anderen na lezen van de lesbrief meer over het onderwerp te weten zijn gekomen. Het moet een heldere en inzichtelijke tutorial-achtig verhaal zijn, gericht op een doelgroep van MT-studenten die met Games (en GameMaker) aan de slag gaan (dus nog niet zoveel kennis hebben). NB. Dus niet de lesstof of lesreaders of bestaande tutorials kopià «ren en aanbieden, maar zelf een uitgebreider verhaal maken, waaruit het behandelde item (en de bijbehorende sub-items) duidelijk uitgelegd worden. Zodat ook duidelijk wordt dat je jezelf er in verdiept hebt. In principe is ieder onderwerp mogelijk, als het aansluit op het vakthema GameTechnologie en/of GameDesign. Onderwerpen moeten eerst voorgelegd worden voor goedkeuring. De lesbrief behandelt deze dan door de te presenteren historie, achtergronden, theorie, voorbeelden, à ©Ãƒ ©n of meerdere oefeningen en tot slot een toekomstvisie van jezelf op het onderwerp. Kies een onderwerp welk aansluit op je eigen 'gerichtheid' ; waar ben je goed in – waar heb je feeling mee – waar wil je jezelf verder in verdiepen; dit om tot een lesbrief van een zinvol niveau te kunnen komen. Onderwerpen kunnen zijn (maak keuze of doe een voorstel voor eigen onderwerp): Basic game technologies (kies een van onderstaande items): *Behavior and Motion : reactive behavior rule-based systems in games agents and bots in games Finite State Machines *Motion control Interaction models Motion planning Collision detection †¢ path finding 􀂃 collision detection 􀂃 AI principles MT – programma E&T – vak ETGRS2 jan. 2005 NWH, 4-4-05, pag. 2 / 2 †¢ Essentials of a (good) game 􀂃 Rules 􀂃 Play 􀂃 Meaningful Play 􀂃 the game System 􀂃 Magic Circle 􀂃 Procedural Representation Basis opbouw 'lespresentatie': Een lespresentatie is een helder, overzichtelijk, verdiepend college aan de andere studenten over een bepaald thema of onderwerp binnen het domein van Graphics&Sound. Een makkelijk leesbaar, tutorial achtig document, met beeldmateriaal (screenshots, movies etc.) waarin het onderwerp duidelijk wordt behandeld.

Ethical Issues in Oroonoko: Slavery

For years, man has illustrated his willingness to perform injustices to those weaker than he. From the bully in the schoolyard, to the king and his court, it seems that man has a desire to control and dominate others. Oroonoko, by Aphra Behn, illustrates that slavery is unethical, humiliating, demoralizing, and worse than death. Oroonoko is a powerful story about the tribulations of a gallant prince named Oroonoko. Throughout the novel, he is shown to be a brave prince and a friend to many. He is given command over an army and shows his military and strategical prowess by winning his battles and conquering his enemies. In the beginning of the novel, the prince presents Imoinda, the daughter of his foster father, with a gift of slaves that had been captured in his victorious battles. For Oroonoko, slavery was accepted and part of his daily life. However, in the novel, Behn presents slavery as a controversial and central issue towards the downfall of Oroonoko. Is it ethical to enslave another human and own them like a piece of property? What does the novel say about an issue such as slavery? The book, in fact, condemns this type of horrific behavior. She illustrates this issue by showing that slavery is demoralizing and humiliating to the people who are involuntary subjected to this kind of torment. In the beginning of the story, Behn describes the native people of Surinam, a colony in the West Indies, as beautiful, respectable, and friendly. Behn says, â€Å"for those we live with in perfect amity, without daring to command ‘em; but, on the contrary, caress ‘em with all the brotherly and friendly affection in the world. † The natives are very useful to immigrants who came from other areas of the world into Surinam. Behn thought of them as being helpful because she could learn their culture and their everyday style of life. Behn finds it, â€Å"Necessary to caress ‘em as friends, and not to treat ‘em as slaves. † Here, Behn says that treating the people of Surinam as slaves is improper and immoral. She says that friends should not be enslaved because they are helpful and caring. Through this effect, Behn considers slavery as an unethical issue. In the novel, Behn displays slavery as an issue that is associated with misery and torment. This occurs when the prince encounters the English captain who deceitfully places Oroonoko and others in captivity. Oroonoko is portrayed in a state of suffering when he is enslaved, â€Å"We were no sooner arrived but we went up to the plantation to see Caesar; whom we found in a very miserable and unexpressable condition; and I have a thousand times admired how he lived in so much tormenting pain protesting our innocency of the fact, and our abhorrence of such cruelties. † While Oroonoko is at the plantation, his attitude is different from when he was the commander of the army. He is miserable, sad, and in a position with less power than he had before. In conjunction with the misery that is involved with slavery, the actions that coincide with a slave such as whippings are also condemned in the novel, â€Å"No, I would not kill myself, even after a whipping, but will be content to live with that infamy, and be pointed at by every grinning slave. † Behn depicts a slave as someone one who is mentally and physically humiliated. In general, public humiliation is and torment is an unethical issue and Behn’s portrayal of misery, humility, and torment proves that slavery is immoral Oroonoko. In Oroonoko, Behn creates a mindset that favors death over slavery. One situation in the novel where slavery is condemned is when the king threatens to send Imoinda off to another country to be sold as slaves. â€Å"He ought to have had so much value and consideration for a maid of her quality as to have nobly put her to death, and not to have sold her like a common slave; the greatest revenge, and the most disgraceful of any, and to which they a thousand times prefer death. † She states that slavery is the perfect revenge against someone who has deceived another. The king orders, that â€Å"they should be both sold off as slaves to another country, either Christian or heathen, ’twas no matter where. This cruel sentence, worse than death, they implored might be reversed. † After constantly repeating the idea of someone preferring death many times over slavery in the novel, Behn shows the reader that slavery is unethical. In conclusion, Behn shows that enslaving a friend is wrong, and that slavery brings about humiliation, torture, and grief. Behn uses the morbid effects of slavery to the extent when she categorizes slavery as being many times worse than death. Using these techniques, Behn gives an immoral connotation to slavery in Oroonoko.

Tragedy of Romeo and Juliet

Romeo and juliet essay : who plays a tragedy Romeo and Juliet: Who is Responsible for the Tragedy? Does Fate play a role? Who is responsible? This question is always asked of any conflict, and usually no one wants to admit that it was his or her fault. It then must be determined what the conflict was, who is responsible, and to what extent. Shakespeare’s, Romeo and Juliet, is based on a conflict. In Romeo and Juliet the conflict turns into a tragedy. Now that we know what the conflict was, which is a tragedy, the next step is to determine what a tragedy is?A tragedy is a conflict that ends up with something very sad happening. In Romeo and Juliet, the tragedy, is that both of these lovers kill themselves, to join the other in death. â€Å"For never was a story of more woe Than this of Juliet and her Romeo† (5,3,309-310). The next step in the problem solving process is to assess who is to blame for the tragedy. To do this we must first determine the different types of ro les played in a conflict. There are 5 main roles; there is cause, an instigator, retaliator, passivist, and moderator.The first is the cause, which can be a person or thing, that starts everything, and sometimes people don’t even realize that they are playing this part. In Romeo and Juliet, one of the causes is the ancient feud between the families. Tybalt says â€Å"What, drawn and talk of peace? I hate the word, as I hate hell, all Montagues and thee. † (1. 1. 61-62) The second is the instigator, who is usually very mean, and something that they do or say, is usually the cause of conflict. What this person does or says is meant to provoke someone.Tybalt says to Romeo â€Å"Romeo, the love I bear thee can afford No better term than this: thou art a villain. †(3. 1. 53,54). These words are designed to provoke Romeo to fight. The third role, is that of the retaliator, who responds to the provocative nature of the instigator. Mercutio says to Tybalt â€Å"Consort ? What, dost thou make us minstrels? And thou make minstrels of us, look to hear nothing but discords. Here’s my fiddlestick, here’s that shall make you dance†(3. 1. 40-43) in retaliation to a verbal jab made by Tybalt. The fourth is the passivist, who does nothing to hinder or help in the conflict.Usually someone who hasn’t decided who is right and hasn’t picked a side. The fifth is the moderator, who is trying to prevent or stop the conflict from happening. Benvolio is trying to prevent a fight when he says â€Å"I pray thee, good Mercutio, let’s retire: The day is hot, the Capels are abroad, An if we meet we shall not escape a brawl, For now, these hot days, is the mad blood stirring. † Now that we have determined the roles played in a conflict, it makes the next step, of determining who is responsible, and to what extent easier. Shakespeare wrote this tragedy with a lot of complexity to it.I know this because each of the people inv olved play more than one role throughout the play. First the Ancient Grudge, is a cause of fighting between the families. It has played a major role in the development of hatred in some of the people, for instance, Tybalt has picked up a hatred for the Montagues, from his Uncle Old Capulet. This Ancient Grudge has caused two brawls previous to the one we see at the start of the play. Prince says â€Å"Three civil brawls, bred of an airy word, By thee, old Capulet, and Montague, Have thrice disturbed the quiet of our streets. †(1. 1. 1-83) By this speech we learn of the nature of the ancient grudge. I believe that the ancient grudge is to be blamed for quite a bit of the tragedy, seeing as none of the fighting would have happened if there was no grudge, and Romeo would have been allowed to marry Juliet, without the secrecy. Second Tybalt is to be blamed for most of the tragedy, because he started the first fight on the street. He also started the fight on the beach. He killed Mercutio, which caused Romeo to retaliate and kill him. Throughout the play Tybalt is always the instigator, he is always looking for a fight.He says himself that he hates peace â€Å"What, drawn and talk of peace? I hate the word, as I hate hell, all Montagues, and thee. †(1. 1. 61,62) Romeo played an important role in the tragedy, but should not be blamed for any of the tragedy. He played the role of a Moderator, most of the time, like when he was on the beach and Tybalt challenged him to fight he says â€Å"Tybalt, the reason that I have to love thee Doth much excuse the appertaining rage to such a greeting. Villain am I none; Therefore farewell, I see thou knowest me not. †(3. 1. 5-58) He also plays the role of the retaliator when Tybalt kills Mercutio. Romeo goes after Tybalt to avenge Mercutio’s death. Romeo says â€Å"for Mercutio’s soul is but a little way above our heads, staying for thine to keep him Company: Either thou or I, or both must go w ith him. †(3. 1. 117-120) so in this sense Romeo’s only fault was that he killed Tybalt, but Tybalt had tried to kill him, and had killed Mercutio, so Romeo should not be blamed. Mercutio’s is but, a very little bit to blame, for his own death, which made Romeo kill Tybalt, and then get Banished for that crime.Mercutio wasn’t going looking for a fight, But he wasn’t looking not to fight either. When Tybalt, comes and wants to fight, so Mercutio responds by challenging him to a fight as well. Mercutio says, â€Å"Here’s my fiddlestick, here’s that shall make you dance. †(3. 1. 41,42) We also learn that he is very proud. â€Å"Men’s eyes were made to look, and let them gaze; I will not budge for no man’s pleasure, I. †(3. 1. 47,48) From these passages, from the book, I have decided that Mercutio played the role of the retaliator.Therefore his fault is only in that of Tybalt’s, so that he should only be slightly blamed. Benvolio’s Role in this conflict was nothing but as a passivist/moderator. I came to this conclusion when he says things like â€Å"I pray thee, good Mercutio, let’s retire: The day is hot, the Capels are abroad, And if we meet we shall not escape a brawl† And â€Å"We talk here in the public haunt of men: Either withdraw unto some private place, or Reason coldly of your grievances, Or else depart; here all eyes gaze on us. †(3. 1. 43-46) By these speeches he is always trying to prevent or postpone the fight.In this case Benvolio is not to blame at all, but rather should be commended for his attempts for peace. Friar Lawerence is to be blamed also, for he had great idea’s of peace after he married Juliet to Romeo. He validated the marriage of these two people, because of his ideas, and he didn’t do the right thing, which would be to tell the parents, and make them see that Romeo and Juliet were really in love. And to let the parents decide what would be best. He messed that up, and then he messed up some more, when he helped Juliet to deceive her parents, by faking her death.He continues to screw up to protect his original mistake of marrying Romeo and Juliet. Juliet’s Parents also contributed by forcing her to marry Paris, and this forced her to fake her death, to get out of her marriage, and to get to Romeo. They were unaware of her previous marriage, so it is not really their fault. After determining this, there is still some confusion over the fault of some people, so that we have to look upon another factor, which may make things a little clearer. That factor is fate. Before determining what role fate played we must first determine the meaning of fate.Fate stems from the Ancient Greek Mythologies, when there were three female goddesses, who were believed to spin a thread that was your life, and they would shake it, to shake up your life. It was also believed that the Fates were in charge of when you died and when you did die, they cut the thread. To make that more clear, Fate, is when something happens or is going to happen, and you have no control over it. It tells us right in the prologue that Romeo and Juliet’s love is fated â€Å"A pair of star-crossed lovers take their life. I don’t really believe in fate, but in this fictional tragedy, fate was an excellent choice to explain some of the things that happened. In conclusion this exciting tragic romance, has utilized a intricate web, in the responsibility for the tragedy, so that no one can be held entirely responsible, and no one is left without a part in tragedy. The way that Shakespeare makes a person play more than one of the basic roles, throughout the conflict, is a stunning way to spark interest, because people are confused by a sudden change of attitude or character. This process leaves the audience, trying to understand, so they become intrigued.

Allure Cruise Line Essay Example

Allure Cruise Line Essay Example Allure Cruise Line Essay Allure Cruise Line Essay Case 15: Allure Cruise Line: Challenges of strategic growth and organizational effectiveness (Part 4) Read the following case from your textbook: (open the other attachment for the article) Analysis: Write a case analysis in about 4 to 5 pages or more. Answer all the case questions in the text. Offer analysis and evidence to support your conclusions. Be objective in interpreting evidence. Don’t present one-sided arguments. Include and answer the points not favorable to your position. Write information and arguments clearly. Use bulleted lists where appropriate. Use tables or charts and graphs to present quantitative information if possible. Format: Present your case analysis in Microsoft Word document format. Please applied the correct APA style, cite inside and outside resources and references (very important). No copy and paste do it in your own writing, because it will be check by the professor before grading by (www. turnitin. com) please no plagiarism paper. P. S: Use academic resources (at a minimum, the textbook) to best address this assignment. Assignment Grading Criteria| Maximum Points| Answered all case questions. | 12| Presented original analysis of the case supported by reasons, examples, and research. | 12| Presented qualitative and quantitative information in appropriate formats. | 4| Contributed to the discussion by drawing conclusions about the results of others’ research, specifically, and by asking questions, providing statements of clarification, providing points of view with rationale, challenging points of discussion, or making relationships between one and more points of the discussion. | 12| Applied the correct APA style, usage, grammar, and punctuation in case analysis. | 4| Total:| 44|

10 Critical Essay Topics on Environmental Health and Development

10 Critical Essay Topics on Environmental Health and Development Writing critical essays on environmental health and its effects on development is a task that could be assigned to just about anyone pursuing a degree in a higher institution of learning. Therefore, it is important to arm yourself with enough ammunitions- facts and figures- concerning the subject of environmental health and here, we will attempt to put together 10 important facts on it. To kick-start the learning process, here is an academic definition of environmental health and development. Environmental health is the science that studies the effect of civilization, culture, personal habits, pollution, population growth and travel on human health as well as the development of the human community. The study takes into account a variety of parameters and factors that lead to acquired or congenital diseases among humans. The data provided for acquired diseases covers the illnesses humans acquire from harmful chemicals, pollution and pathogenic elements while that for congenital diseases covers genetic issues contained in the human DNA. Therefore, a study on environmental health focuses more on acquired diseases and the role the environment plays in our healthy or unhealthy situation. So here are some facts spanning the environment’s contribution to the state of our mental health, wellness, and overall standard of life in the 21st century: The past twenty years have seen plastics replacing the use of glass, metal and other material as the major production material used in manufacturing products. In 1995, studies found that plastics leak pollutants which affect the environment and the endocrine system of the human body. The endocrine system is responsible for growth and reproduction and the effects of these emissions stunt human development. Sadly, approximately 6.6 million children under the age of 5 die every year on the global stage due to diverse contributing factors. But statistics show that environmental-related deaths account for a third of this number. Also important is the fact that 50% of the one million child deaths from acute respiration are caused by indoor smoke- which consist of second hand tobacco smoke and solid fuel used in stoves. In terms of diseases and environmental health, asthma is the most common non-communicable disease that occurs among children. Studies show that it is caused by emissions which are hazardous to the environment such as dust, smoke, pollen and mould. Children in more developed countries are more susceptible to having asthma, while sufferers from poor income backgrounds are more likely to die from asthmatic attacks due to lack of access to good health care facilities. The causes of natural disasters range from human impact to just nature. Their effect on health and development are quite staggering. Statistics show that since 1980, environmental disasters have led to economic losses of approximately $3.2trillion worldwide. Sadly, low-income countries account for approximately 70% of the world’s natural disaster hot spots which affect more than 200 million people from the developed world. The average human being also plays a part in ensuring the environmental health in his or her community and this affects the development and standard of living in these communities. In 2012, statistics show that 14% of the world’s population practices open defecation and 9 out of every 10 who practice open defecation live in rural areas. The study also showed the percentage of people who defecate in the open is also on the rise in the developed world which affects the environment negatively. The earth’s ozone layer is drastically reducing due to the use of ozone depleting substances (ODS) produced by humans and this harms the environment for it reduces the protecting shield that protects humans from ultraviolet (UV) rays. Cars, refrigerators, air conditioners contribute approximately 30% of the emissions that affect the ozone layer. UV rays are produced more predominantly between 10am to 4pm and overexposure may lead to skin burns and in more serious instances, skin cancer. Lead poisoning is a scourge to environmental health and although the use of lead in production cycles has been reduced in developing countries, high levels of lead can still be found in the environment. Studies show that lead can harm a developing foetus and cause reproduction problems in adults. Lastly, in developing countries, more than 33% of their child population are exposed to high levels of lead which can result to neurological disorders which harm child development. Water contamination has been described as one of the hazards that plague humans, the environment and animals residing in its ecosystem. Studies show that most of the world’s water sources- tap water, well water and bottled water- exhibit traces of contamination such as fluorine, lead and bacteria- and in high concentrations, it can lead to health hazards. In developing nations, water contamination is responsible for illnesses such as cholera and dysentery which affects the healthy development of individuals in these communities. Mining and drilling to retrieve the earth’s resources also have repercussions on the environment and in most cases these repercussion are negative and harmful to environmental health. Studies have shown that a high percentage mercury- which is one of the byproducts from burning coal- finds its way to the world’s lakes, rivers and oceans thereby affecting both plant and animal life globally. Humans are also in danger of mercury poisoning as methylmercury can be found in high concentrations in sea foods exposed mercury. Environmental health is also susceptible to the widespread use of pesticides by humans in killing pests, gardening and treating mold. Studies show that over exposure to pesticide poses greater risk to children than adults and these health risks include: birth defects, nerve damage and cancer. Statistics show that an estimated 1million to 5million cases of pesticide poisoning occur each year and this leads to approximately 20,000 deaths which show the effect of pesticide to environmental health. So here we come to the end of some of the most important facts on environmental health and development which you can integrate into your essay. We would like you to note that this article is just the first in a series providing you with excellent information on writing an essay or handling a project on environmental health. Therefore, we implore you to complete the series by checking out some interesting topics which you can choose from for your own essay as well as these guidelines on writing a critical essay. References: Mike, A. Thutula, B. (2013). Development in Environmental Health, 7-12. hst.org.za/uploads/files/chap10_08.pdf Women’s Health journal. (2012). The Environment and Women’s Health, 3-7, 10-16. http://womenshealth.gov/publications/our-publications/fact-sheet/environment-womens-health.pdf World Health Organization. (2008). Environmental Health. who.int/topics/environmental_health/en/ World Health Organization. (2008). 10 facts on preventing disease through healthy environments. who.int/features/factfiles/ environmental_health/en/ Bartram, J. (2008). Flowing Away: Water and Health Opportunities. Bull World Health Organ. who.int/bulletin/volumes/86/1/07- 049619.pdf Van Vuuren, L. (2006). Potential health time-bomb ticking in Free State. The Water Wheel. Encyclopaedia. (2002). Environmental Health. encyclopedia.com/topic/Environmental_health.aspx

5 Ways to Work Your Way Around the Weak With

5 Ways to Work Your Way Around the Weak With 5 Ways to Work Your Way Around the Weak â€Å"With† 5 Ways to Work Your Way Around the Weak â€Å"With† By Mark Nichol The preposition with is one of the workhorses of the English language, performing multiple functions, but it’s not a very powerful beast of burden. Writers often put it to work at the wrong task, employing it to link one phrase or another when a stronger word or phrase, or a form of punctuation, is much more structurally sound. Here are five examples of sentences better expressed without with: 1. â€Å"Requirements concerning the marital status of adopting couples are not uniform, with a stable relationship being required in most cases.† Omit with, split the sentence into two, and add, to signal contrast, the conjunction however: â€Å"Requirements concerning the marital status of adopting couples are not uniform. A stable relationship, however, is required in most cases. 2. â€Å"Governance by committee is the norm, with 67 percent of large companies having committees of senior business leaders that oversee and prioritize information-technology investments.† If what follows with is a definition or expansion, use a colon in its place: â€Å"Governance by committee is the norm: 67 percent of large companies have committees of senior business leaders that oversee and prioritize information-technology investments.† 3. â€Å"The debate largely focused on the wisdom of the Iraq invasion with Kerry attacking Bush’s decisions and Bush accusing Kerry of shifting views.† As is, this sentence is clumsily breathless, but rather than simply inserting a missing comma after invasion, try a semicolon instead and delete with: â€Å"The debate largely focused on the wisdom of the Iraq invasion; Kerry attacked Bush’s decisions, and Bush accused Kerry of shifting views.† 4. â€Å"Each year, more than 1 million children are poisoned in their own homes, with thousands receiving permanent or chronic injuries.† Make the sentence a simple compound by replacing with with and, and alter the following subject and verb as necessary: â€Å"Each year, more than 1 million children are poisoned in their own homes, and thousands of them receive permanent or chronic injuries.† 5. â€Å"Most Fortune 500 companies have hundreds of incidents per year, with only a small percentage of those incidents resulting in significant financial loss.† Select, in place of with, another conjunction that is appropriate for the context, and change the form of the subsequent verb: â€Å"Most Fortune 500 companies have hundreds of incidents per year, although only a small percentage of those incidents result in significant financial loss.† Want to improve your English in five minutes a day? Get a subscription and start receiving our writing tips and exercises daily! Keep learning! Browse the Grammar category, check our popular posts, or choose a related post below:100 Words for Facial ExpressionsLoan, Lend, Loaned, Lent50 Synonyms for â€Å"Villain†

Evaluation of the evidence for and against stem cell plasticity Article

Evaluation of the evidence for and against stem cell plasticity - Article Example This can be translated to mean that the highly regenerative tissues have stem cells while those that are poor regenerators lack stem cells (Frank, Schatton & Frank 2010, p. 41). However, cells that have been believed to be non-regenerators such as the heart and the brain have lately shown signs of regeneration. This has opened the doors for researches in stem cell population and their regenerative potential. Studies of tissue injury repair have discovered that there is a strong support for important stem cell functions in the hematopoietic system, dermal epithelium, intestinal epithelium, and skeletal muscle. This is a clear indication that stem cell plasticity can be of high importance in repairing of damaged cells in these tissues (Langer, Vacanti &Lanza 2014, p. 231). Hematopoietic stem cells (HSC) exist predominantly in the bone marrow of human beings. They have always been known to serve the purpose of generation all lineages of mature blood cell types that are needed for the maintenance of proper hematopoietic function (Cetrulo, Cetrulo&Cetrulo 2009, p. 234). However, a series of studies have challenged this assertion. These studies suggest that if bone marrow cells are enriched by hematopoietic stem cell activity, they could appear to be of contribution to the lower levels of multiple nonhematopoietic tissues because of injured or irradiated recipients (Bhattacharya & Stubblefield 2014, p. 199). These studies reveal that these activities can result to nonhematopoietic cells within the skin, intestinal epithelium, lung epithelium, kidney epithelium, pancreas, liver parenchyma, skeletal muscle, and myocardium. Some of the support for the stem cell plasticity comes from opposes of abortion. The main reason as to why this group of people is in support of stem cell plasticity is the fact that a majority of stem cell researchers always use embryos that were created in virto fertility treatment. These are the embryos that were produced but were never used. Most

Science and Religion Research Paper Example | Topics and Well Written Essays - 750 words

Science and Religion - Research Paper Example What are, for instance, the fundamental characteristics of science and how do those characteristics differ from those of religion? These kinds of central questions, dealing with both metaphysics and epistemology, are incredibly relevant to modern society, which is increasingly realizing the importance of science’s contributions to quality of life. Nevertheless, while progress in scientific discoveries is being made, religion remains in the background, still likewise central to people’s lives. The questions of science’s relationship to religion have, for all intents and purposes, existed since the classical ages when the first scientific methods were being developed. With this background in mind, it is crucial to remember that these sorts of questions have inspired lively debate for centuries, with the weight of many strong arguments behind them. The purpose of this paper is to draw the landscape of these arguments, their theoretical force, and how to resolve them . The argument is whether science is in fundamental conflict with religion, or whether there is a degree of concordance between the two realms of human knowledge. Those who believe that religion is fundamentally different think that the scientific method is the defining feature of a scientific state of knowledge, which is a feature that is not shared by religion (Dawkins, 2003). Religion, which largely focuses on the value of knowledge derived from revelation and authority, does not take trial-and-error learning as the true method of knowledge. For those who believe there is concordance between the two, the argument relies primarily on the notion that divine creation that underwrites the empirical character of modern Western science and its greatest minds in history (Ratzsch, 2009). The best-defended position in this debate is that there is no conflict between religion and science, but that there is no agreement between them either. Basing a concordance between religion and science on the observation that many of the earliest heroes of science were Christian (including Galileo, Boyle, and Kepler) is fallacious. Many of these early scientific heroes often experienced deep philosophical and political conflicts between their religious beliefs and their scientific theories. For instance, the well-known case of Galileo’s trouble with the religious authority over his scientific findings is a commonly given example of a scientific figure being persecuted because of that essential conflict. Likewise, one could also argue that the religious authority that persecuted Galileo based on his scientific findings were not acting on behalf of a genuine religious belief. The Church, which had established its own scientific conclusions through centuries, took measures to enforce those scientific conclusions through coercive force. The thought there is that a religious authority can adopt science and enforce that science in the name of God, which separates it from a religi ous belief (Ratzsch, 2009). The reason that this position is best defended is because it is difficult (a) to define what exactly constitutes science and religion, and (b) to define what exactly constitutes conflict and agreement. An example of the difficulty with (a) is Behe (1996)’s arguments for the theory of intelligent design based on the concept of â€Å"irreducible complexity.† Intelligent design, which is based on a theological theory of the origin of species, is taken to be the antithesis of evolutionary theory in biology. However, the arguments are written in such a way that they are presented as scientific evidence, even though they are based on theological premises. This seeming mixture of science and relig

Personal and Organizational Ethics Essay Example | Topics and Well Written Essays - 2000 words

Personal and Organizational Ethics - Essay Example Therefore utilitarianism in developing morals seeks to develop an account of moral evaluation and moral direction that expands it. Ferrell & Fraedrich (2010) argues that relativism perspective indicates that ethical behavior is derived from the experiences of individual groups and individuals. Therefore, relativists view themselves or the people around their areas, as their basis for defining ethical standards. These are the guiding principles behind developing morals and ethics that form the personal ethics, which have to be exercised on a personal basis and have to be exhibited in private and in any organization. Personal Morals and ethics Largely, my personal values are more shaped by having a good interaction with others. The values that I hold include viewing each and every one as important and having a purpose either in private life or in the organization. Through these values, I have learned to listen to others with keen interests and offer due diligence to their perspectives. Each and every one has a point of view that can be important, and which if followed would offer a better understanding or aid in performing better in a certain perspective. Through these values, I have managed to relate well with others, and earn respect, honor and many leadership positions that I have excellently found myself in. These have put me in a better place to lead a larger setting such as an organization. Through these values, I have always developed an elaborate code of ethics that have aided in achieving good relations with people. As argued above, the principle of utilitarianism requires that one has to increase the good of action to others or promote the benefit that a certain action has to present. This in addition indicates that we have to abide within strong professional and individual ethics that are related. Velasquez (2008) argues that ethics are the rules in which one has to operate. It is through morals that are derived in my values that the rules of action in ethics are derived and have enabled me to cope harmoniously both on private platform and in an organization setting. Ethics are based on morals in that as Velasquez (2008) argues morals are standards of individual that regard what is good or bad , and in the principle of utilitarianism, a good act has to be advocated, leading to being morally upright and hence ethical in practice. The personal mission is always to act ethically and uphold my esteem in private and in an organization level and value the importance and purpose of others whom we have to have close contact in official and unofficial basis. The vision is to be helpful and create value to the lives of others in the organization through my strategic operations or interaction. This is the roadmap through which I have to achieve the overall growth and development on personal basis and in the organization. Organization’s mission statement The mission of the company is â€Å"to sustain commercial success as a global ma rketing company of branded casual apparel. We must balance goals of superior profitability and return on investment, leadership market positions and superior products and service. We will conduct our business this way and demonstrate leadership in satisfying our responsibilities to our communities and to society. Our work environment will be safe and productive and characterized by fair

Computer System Crash Assignment Example | Topics and Well Written Essays - 250 words

Computer System Crash - Assignment Example If this occurs, and the computer user has stored information on their machine’s hard drive, but has not backed it up in any other way, the consequences can clearly be serious. In some cases data is recoverable from the hard drive when it has been removed from the computer, but this is not always possible. A student might lose all of their research data for an assignment, project or dissertation; a business person might lose data vital to the day-to-day running of their commercial operations. It is true that more recent operating systems, including Linux, and newer versions of Windows, are more likely to recover after a crash, when the machine’s hard drive has been scanned, errors have been repaired, and the system rebooted. Even if this all goes smoothly, data which was unsaved at the time of the crash may not be recoverable. However, there are several means by which data can secured, so that even if it cannot be recovered after a system crash, it can be accessed on a different machine. The most popular forms of external storage are USB mass storage devices, and external hard drives. The latter are usually able to store as much data as a PC, but the device can be connected and disconnected from a computer, and so data backed up using such devices will be safe in the event of a

The Wedding Story Essay Example | Topics and Well Written Essays - 750 words

The Wedding Story - Essay Example Significance of the use of Simile in Literature IV. Conclusion V. References The Use of Simile in Julianne Homokay’s The Wedding Story A literary device is a technique that the writer uses for a given literary purpose (Niazi & Gautam, 2010). Literary devices can be any form of method or procedure that the writer/artist uses to express ideas through language, and produce a desired effect on the reader/audience. Examples of common literary devices used are Allegory, Analogy, Climax, Foreshadowing, Hyperbole, Metaphor, and Simile. As in any piece of good literature, Julianne Homokay’s The Wedding Story is also filled with literary devices that make the drama come to life. Homokay used a number of different literary devices to make the drama a comedic take on criticizing the conventional pictures that men and women are pictured as, especially in the confines of marriage. Thus, The Wedding Story may be considered as a farce, because it is a comedy in which the plot took an u nfortunate, almost exaggerated twist. One particular literary device used repeatedly in the drama is Simile. Simile is a literary device known as a figure of speech, which makes a comparison between two dissimilar objects using as, like, or as though (Bertens, 2008). Since similes are essentially a group of descriptive words, they are able to paint a clearer picture in our minds as opposed to when they are left out in a text. Since the actual object used in the text may be an abstract one, using simile to liken it to a more concrete and visually engaging object gives the reader a chance to create a more vivid picture of the scenario in his or her mind. Simile, as a figure of speech, is very similar to metaphor, except that comparisons are made without the use of as, like, or as though. In The Wedding Story, simile was used in the dialogue to emphasize particular points. The narrator, who may be considered as the protagonist in the story, reads from his book and talks of a â€Å"wom an, pretty as a day in June.† This comparison paints the woman in the minds of the reader as someone who is young, fresh, and vibrant, comparable to the vibrance of June’s summer. Of course, the bride and groom (who may be labeled as the antagonists of the drama), clarifies that the bride bears no resemblance to a pretty day in June because she was a middle aged woman who had to get married for convenience. The bride C. How did the use of Simile as a literary device contribute to the drama VI. Significance of the use of Simile in Literature VII. Conclusion VIII. References A prominent literary device used in the drama was

Engineering - Anaerobic Digestion Essay Example | Topics and Well Written Essays - 2000 words

Engineering - Anaerobic Digestion - Essay Example Leading in the Go Green, campaign is biogas. Biogas is defined as a mixture of carbon dioxide and methane gas, which is sourced from the breakdown of organic matter, usually waste, in a process referred to as anaerobic digestion. The process is a method by which raw biogas is converted into cleaner, efficient and easier used energy sources. Planning a biogas plant Designing a biogas plant is an engineering problem that has to be approached by considering all the operational, economic, environmental and sustainability conditions. Before designing the biogas plant in the Middle East, the engineer has to first engage in plans, which are conceptualized ideas, but not suited for any one given application. In planning, some of the considerations to look into include the naturally occurring resources, agricultural development, social conventions, customer energy requirements and possible construction site. Careful planning is necessary to eliminate present and cumulative or multiplier effec ts on the design. As a biogas digester (production unit) is a costly investment, it cannot be simply set up as a temporary station. Design The design of the biogas unit is dependent on the conditions a given society poses to the objective. A biogas unit is affected by numerous conditions such as the environmental conditions, design and socio-economic conduct of the people of that region. The choice of the design is determined by the conditions of the chosen site. Designing a biogas unit in the Middle East is a generalized idea, to come up with a perfect unit, the engineer has to analyse the conditions and challenges a given site provides. Just as any system, the biogas production plat is affected by the input and any additional disturbances, which are reflected in the output (which in our case is biogas). Physical conditions Physical conditions are one of the most influential factors when it comes to designing and setting up a biogas digester. Since the anaerobic process of biogas p roduction is quite sensitive to temperature, then care should be taken in considering the climate of a given locale. Other conditions apart from the climate of a location that may be put to test include the soil conditions, the feedstock or substrate for digestion, and the available building material. The design considerations in terms of the substrate and size of the digester are determined by the consumers as well as the available building material. Insulation of the digester happens to be the main consideration in setting up the plant. The anaerobic process operates at temperatures of between 30 and 60 C. keeping the temperature between these limits is of great necessity to ensure that the bacteria involved in the digestion process lives, for high or low temperature leads to their death. Skills and labour Another requirement in designing is skills and labour. The technology involved in setting up a biogas plant is sophisticated and requires skills from both the constructors and d esigners. The complexity of the design usually dictates the type and level of skill involved in the construction process. Depending on the size, distance and costs, the biogas digester may be prefabricated or made in-situ. Standardization Although plants may be designed to fit the needs of a given consumer, there is a need for standardizing the design.

The Wedding Story Essay Example | Topics and Well Written Essays - 750 words

The Wedding Story - Essay Example Significance of the use of Simile in Literature IV. Conclusion V. References The Use of Simile in Julianne Homokay’s The Wedding Story A literary device is a technique that the writer uses for a given literary purpose (Niazi & Gautam, 2010). Literary devices can be any form of method or procedure that the writer/artist uses to express ideas through language, and produce a desired effect on the reader/audience. Examples of common literary devices used are Allegory, Analogy, Climax, Foreshadowing, Hyperbole, Metaphor, and Simile. As in any piece of good literature, Julianne Homokay’s The Wedding Story is also filled with literary devices that make the drama come to life. Homokay used a number of different literary devices to make the drama a comedic take on criticizing the conventional pictures that men and women are pictured as, especially in the confines of marriage. Thus, The Wedding Story may be considered as a farce, because it is a comedy in which the plot took an u nfortunate, almost exaggerated twist. One particular literary device used repeatedly in the drama is Simile. Simile is a literary device known as a figure of speech, which makes a comparison between two dissimilar objects using as, like, or as though (Bertens, 2008). Since similes are essentially a group of descriptive words, they are able to paint a clearer picture in our minds as opposed to when they are left out in a text. Since the actual object used in the text may be an abstract one, using simile to liken it to a more concrete and visually engaging object gives the reader a chance to create a more vivid picture of the scenario in his or her mind. Simile, as a figure of speech, is very similar to metaphor, except that comparisons are made without the use of as, like, or as though. In The Wedding Story, simile was used in the dialogue to emphasize particular points. The narrator, who may be considered as the protagonist in the story, reads from his book and talks of a â€Å"wom an, pretty as a day in June.† This comparison paints the woman in the minds of the reader as someone who is young, fresh, and vibrant, comparable to the vibrance of June’s summer. Of course, the bride and groom (who may be labeled as the antagonists of the drama), clarifies that the bride bears no resemblance to a pretty day in June because she was a middle aged woman who had to get married for convenience. The bride C. How did the use of Simile as a literary device contribute to the drama VI. Significance of the use of Simile in Literature VII. Conclusion VIII. References A prominent literary device used in the drama was

Explorer Essay Example | Topics and Well Written Essays - 500 words

Explorer - Essay Example Little did we know that this peculiar personality of his could be a problem solver and even a life-saver. This happened when we went hiking. We used to do an overnight hiking and do camp outs in the forest. We already know the routine of what to bring during a camping. The tent, blankets, insect repeller, even first aid kit were almost always ready for us to bring as a logistical support. For food, we bring ready to open canned goods because of its convenience. Except this once instance where one of my brilliant cousin did the grocery and chose to buy canned goods which does not have the automatic opener (the protruding level like thing that we just have to pull to open the can). Now we are the camping site, miles away from home and in a middle of a night, starving and we are presented with a problem: how can we eat our canned goods when there is no opener. No one also brought a can opener because we are used to the idea that canned goods has its own opener. It was a problem solving situation. Our uncle threw the problem to us for us to find a solution. The solutions that were presented ranged from anecdotal to ridiculous to irritating. A cousin proposed that we skip the dinner for the night as a means to fast. I was hungry and so are other cousins so nobody agreed with his idea. Another bright idea from a cousin who could put us all in danger was putting the canned goods in fire hoping that the heat inside will open the can itself. We are worried however that it might explode or we might just render the food inedible by setting the can on fire. Another idea that was suggested was to smash the can so that it will open. For sure it will open only that we also cannot eat its contents. Until Jim made his typical smirk which we already know he is into something. He brought out his fork and put it on the lid of the canned good (it was spam, I think). Then Mark get it, he immediately jump out of seat and used

The Good Life Essay Example for Free

The Good Life Essay What is the good life? This ambiguous idea differs for everyone. Americans may believe that to live the good life is to live the American Dream and achieve freedom, equality, and prosperity. Others may believe that the good life involves being very wealthy or famous. Over all, the definition of the good life varies for everyone. There isn’t one specific way that a person should live in order for it to be â€Å"good†. However, although the definition of the good life is very diverse and open to multiple interpretations, in order to live the best life possible, one should concentrate on doing whatever makes him or her happy, listening to his or her conscience and doing what it right, and establishing good relationships with family and peers. The most key piece to living the good life is doing whatever makes one happy. For most adults, this could mean having a job in their dream career field, and actually wanting to get out of bed to go to work in the mornings. Or, it could mean not having a job at all. Nonetheless, most adults would be happy by achieving success in their chosen careers, and having stable and loving families. However, a small number of adults actually achieve this ideal happiness. Regardless, the good life is still attainable. In order to live the good life, one has to strive to find happiness in whatever he or she does. According to Ralph Waldo Emerson in his essay â€Å"The Over-Soul†, one can achieve happiness through God and religion. He states that God is accessible to everyone, religious or not, and that religion is essentially the key to all happiness. For Christians, Emerson’s point of view may be correct. Many Christians believe that God can bring happiness to anyone who believes in Him. For non-Christians on the other hand, Emerson’s idea is irrelevant. Still, religious or not, people should strive to find happiness in whatever they do, and they should learn to accept their lives as they are. Even though no one lives a perfect life, people should aim to make the most out of their lives, and learn to find happiness in even the smallest situations. Doing so would allow one to become closer to attaining the good life. Another important part to living the best life possible is listening to one’s conscience and doing the right thing, and actually feeling good about the decisions that are made. If one’s life consists of doing bad things, he or she will ultimately feel bad about them, and many regrets will be left behind. However, if one does a lot of good deeds throughout his or her life, there will be minimal regrets and he or she will be able to work towards living the best life possible. Listening to one’s conscience is also an effective way of avoiding regrets. Many times, when one doesn’t listen to his or her conscience, regrets occur, because one looks back on the decisions made and realizes that they should have done something differently or listened to their conscience. Even though listening to one’s conscience might not always be the right thing to do or yield the best results, it will allow for one to live with few regrets. And, by living with few regrets, doing what is right, and listening to the conscience, one will become closer to achieving their good life, in whatever way it is defined. The last way to live the best life possible is through establishing good and meaningful with one’s family and peers. A lack of friendships and substantial relationships will most likely leave one feeling very lonely and outcast. However, if one can form positive relationships, they will be more social, happy, and closer to achieving the good life. In Gary Eberle’s text, The Geography of Nowhere, Eberle states that electronics and the media are preventing many people from establishing good, intimate relationships with others. Electronics are causing us to be very disconnected from each other: â€Å"The people spend so much of their lives connected electronically to someplace else that most of the time they hardly seem to be there, or anywhere at all, for that matter† (Eberle 2). Here, Eberle is showing how electronics and the media have caused society to be very disjoint, and they have hindered meaningful relationships from forming. So, in order to live the best life possible, we should strive to overcome the power of electronics and try to continue to make successful relationships with others, as healthy friendships are one of the most important pieces to living a good life. Still, working past the power of electronics is not the only way to secure good relationships. In addition, one ought to be a trustworthy person. Trust is essential to all relationships, and if one is trustworthy, he or she will have more satisfying relationships with others. Along with trust, in order to form good relationships, one could be understanding, generous, comforting, and more. Doing so will allow one to develop healthy relationships with their friends and family, and the good life will then be more reachable. Over all, the good life remains a very unclear idea, and there is no concrete definition on what the good life is, nor is there a definite way on how one is supposed to live it. Still, one can work towards living the best life possible by striving to find happiness in his or her life, as well as listening to his or her conscience, doing what is right, and establishing valuable relationships with peers. If one can do all of these things, they will be closer to achieving their definition of a good life.

A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Unknown Mechanism Biology Essay A silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our previous study, G6PD 1311/93 was identified as the common G6PD variant in one of the Malaysian aboriginal groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3 ´UTR of the G6PD gene in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three novel SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3 ´UTR. SNP ss218178024, which is located inside an AG-rich region, has shown a significant association with G6PD 1311/93 as it was observed solely in individuals with G6PD 1311/93. Computational analyses indicated that three miRNAs have potential to bind to the reg ions encompassing ss218178024. Whilst transitions of A to G dose not destroy these miRNA target sites, it extensively alters the mRNA secondary structure and creates a putative hsa-miR-877* binding site. Notably, ss218178027 and ss218178028 do not change mRNA secondary structure. It could be speculated that ss218178024 have a potential functional effect on the down-regulation of mRNA and consequently G6PD deficiency either by affecting mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3 ´UTR of G6PD mRNA. Genetic variations in the G6PD gene are responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants are single missense mutations, with the rest being either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein sequence of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This genotype has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991; 2000; Jiang et al. 2006; Daoud et al. 2008; Jalloh et al. 2008; Wang et al. 2008; Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein sequence of the G6PD enzyme. From previous studies, association of th ese two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004; Wang et al 2008; Jiang et al 2006). It is notable that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency. Importance of 3 ´UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3 ´UTR of a number of genes (ref). In the other word, genetic variations in the 3 ´UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3 ´UTR of human genes are key players in controlling of mRNA stability, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3 ´UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene expression by binding to the 3 ´UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3 ´UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of cancer have been documented (Sethupathy 2008; Shen 2008). Given that, in the present study, we sought to determine if any SNP in the 3 ´UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing. Subjects and Methods This study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent. In our previous study, we attempted to identify the molecular basis of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST000 00393562). Then two regions of the G6PD gene (region ab and cd in figure 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 ´ UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). Figure 1: Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a: 5 AAGACGTCCAGGATGAGGTGATC 3 and b: 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 C>T transition. Oligonucleotides c: 5 TGGCATCAGCAAGACACTCTCTC 3 and d: 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 T>C. Oligonucleotides e: 5 GAGCCCTGG GCACCCACCTC 3 and f : 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing. Bioinformatic Tools We used two computational tools for each section to confirm our results. F-SNP (http://compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http://fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3 ´UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3 ´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3 ´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA. Results Genotyping DNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heter ozygote for ss218178024. Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP. Table 2 SNP Individuals with G6PD 1311/93 individuals normal for G6PD 1311/93 ss218178024 ss218178027 ss218178028 Aboriginal individual 72 105 72 6 4 Non-aboriginal individual 6 37 6 0 0 Bioinformatics Analysis Search for reported SNPs inside of 3 ´UTR of G6PD gene By using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3 ´UTR of G6PD gene including SNP ref ID: rs1050831,  rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.  The last one is actually same with ss218178024. All of these known SNPs were discovered via cDNA sequencing and to date no clinical associations have been reported for them. Prediction of putative miRNA binding sites and mRNA secondary structure The wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico analysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA. Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3 ´UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 ´ end of the miRNA and the 3à ¢Ã¢â€š ¬Ã‚ ² UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows. Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be affected by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type compare with the mutant. In the other word, it is suggesting that altered mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing. Consequently, secondary structure of 3 ´UTR of G6PD mRNA has been also checked for the accessibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G. Genotype Change in secondary structure Change in secondary of full length of mRNA structure of 3 ´UTR 1311T No ss218178024G Yes Yes 1311T+ ss218178024G Yes ss218178027A No No 1311T + ss218178027A No ss218178028T No No 1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3 ´UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of the full-length mRNA and 3UTR is shown in parentheses. Statistical Analysis Discussion A recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Ara ´mbula et al. 2000; Nuchprayoon et al. 2008; Barisic 2005; Laosombat 2005; Pietropertosa 2001; Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the roles played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To th e best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3 ´UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3 ´UTR for G6PD deficient individuals (Nguyen Thi Hue 2009; Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93. The roles in disease phenotypes played by sequence polymorphisms of the 3 ´UTR have been reported (Lambert et al. 2003; Goto et al. 2001; Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full len gth mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the o ther view, SS contributes to interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA reg ulation of G6PD mRNA is reasonable. While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs. . Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken before miRNA::mRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive. Here, we demonstrate that a A357G mutation may potentially change the 3 ´UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet). However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function. In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis. MicroInspector (http://www.imbb.forth.gr/microinspector) (Rusinov et al. 2005) W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issue MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence Ventsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin Tabler Typically, SNPs occurring in functional genomic regions such as protein coding or regulatory regions are more likely to cause functional distortion and, as such, more likely to underlie disease-causing variations. Current bioinformatics tools examine the functional effects of SNPs only with respect to a single biological function. Therefore, much time and effort is required from researchers to separately use multiple tools and interpret the (often conflicting) predictions. (F-SNP Lee at al) The variant ESR1_rs2747648 affects the miRNA-binding site of miR-453, miR-181(b/d) and miR-219. Due to in silico analysis using miRanda (http://www.microrna.org/microrna/home.do), the variant ESR1_rs2747648 does not significantly effect the binding capacity of miR-219 and miR-181(b/d). However, the binding capacity of miR- 453 is stronger when the C variant allele is present, enabling to bind the complementary G nucleotide of the miR-453 seed. In contrast, the T allele attenuates the binding of miR-453, which we hypothesize to lead to a reduced miRNA-mediated ESR1-repression, in consequence higher ESR1 protein levels and an increased breast cancer risk. Therefore, the breast cancer protective effect observed for the C allele is biologically reasonable. However, functional studies are necessary to test this hypothesis. Due to the fact that endogenous estrogen levels are high premenopausal and drop down post-menopausal, it is plausible that the risk effect of this variant can only be detected in premenopausal women. RNA secondary structure prediction was carried out using the Vienna RNA Package 1.7.2. on the web interface for online RNA folding on the Vienna RNA WebServers.42 The target mRNA prediction was carried out using The microRNA.org resource This is likely because miRNA-mRNA binding is mediated by the RISC complex, and upstream and downstream regions of miRNA binding site may interact with RISC, which mediates miRNA-mRNA binding (26). A polymorphism in the 829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirna SNP rs12720208 is located 166 bp downstream of the terminating codon of FGF20 and lies within a predicted binding site for microRNA (miRNA) miR-433. (A) The predicted binding site for miR-433 at 30 UTR of FGF20 gene. At rs12720208, allele C base paired with G in Watson-Crick mode (as shown with a solid line), whereas allele T wobble base paired with G (as shown with a dashed line). ØØ ² Ù†¦Ãƒâ„¢Ã¢â‚¬Å¡ÃƒËœÃƒâ„¢Ã¢â‚¬Å¾Ãƒâ„¢Ã¢â‚¬ ¡ geenbee 2009 capasso Although the mechanism by which interaction of proteins with the G3A sequence might affect message stability remains a matter of speculation, the fact that this sequence is located within a large region of stable secondary structure in the 39-UTR of the elastin mRNA (4) suggests the possibility that RNA/protein interactions at this site may alter the stability of this secondary structure, perhaps affecting the accessibility of endogenous RNases to the mRNA. However, detailed understanding of the mechanism of this process awaits further characterization of the nature of binding protein and the consequences of its interaction with the G3A motif in elastin mRNA. Acknowledgment-We acknowledge GA rich Hew From a physical point of view, we expect that the interaction of a miRNA with its target will depend on the state of the target region prior to interaction. In particular, if the target sequence is already bound (by Watson-Crick base-pairing) to another section of the mRNA chain, this will e_ectively pose a barrier to the base-pairing with the miRNA, and the capacity of such target sequences to mediate translational repression could be diminished. If we were able to predict the accessibility of a potential miRNA binding site, this might improve our target predictions. gi|109132849|AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|108773792| CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|194680256| CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG ***** * ** ** * * * * * **** ** * * * ******** gi|109132849|AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGA gi|108773792| CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGA gi|194680256| CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * ** gi|109132849|AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCG gi|108773792| GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCA gi|194680256| ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTC It would be anticipated that increased DHFR reduces MTX cytotoxicity in normal cells while conferring resistance in target cells. A comparison of the human and mouse DHFR 39-UTR sequences revealed that only 100 nucleotides downstream from the terminator codon were conserved between the two species (18). Numerous studies have focused on the effects of coding region variants on P-gp expression and function, whereas few noncoding region variants have been investigated. Mechanisms that alter mRNA levels can change mRNA expression and potentially G6PD activity. Recent evidence has demonstrated that the 3UTR of mRNA is an important regulatory site controlling interactions with mRNA degradation machinery (Hollams et al., 2002; Tourriere et al., 2002; Mangus et al., 2003; Wilkie et al., 2003). 3UTR RNA-binding proteins that recognize specific mRNA sequence elements and secondary structure dictate the fate of mRNA transcripts. Polymorphisms in the 3UTR of G6PD could disrupt RNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999; Hollams et al., 2002; Tourriere et al., 2002). A polymorphism in the 3UTR of human tumor necrosis factor-_ changes binding affinity for a multiprotein complex that contains the HuR regulatory protein (Di Marco et al., 2001). HuR binds AG-rich elements in the 3UTR of certain genes (Peng et al., 1998) and has been shown to stabilize mRNA containing tumor necrosis factor-_ 3_-UTR sequence motifs (Dean et al., 2001). There is one report that the 3435C_T synonymous variant decreases mRNA stability (Wang et al., 2005), but to our knowledge no pharmacogenetic research of this type has been conducted for ABCB1 3_-UTR variants. Thus, our mRNA half-life data represent novel findings as to the effects the _89A_T, _146G_A, and _193A_G polymorphisms have on ABCB1 mRNA stability and demonstrate the utility of using stable cell lines made with Flp-In technology for these measurements. Similarly

Blue Highways, Leaves of Grass and the Parkdale Library Essay -- compa

Blue Highways, Leaves of Grass and the Parkdale Library I don't know what exactly I expected to find at the library that summer. Rows of gleaming shelves and neatly stacked books, probably. No sound but the humming of fluorescent lights and the thump of rubber stamps. The librarians would be demure types - soft-spoken and intellectual. I thought of the place itself as a sort of solemn temple to the written word. With these images in mind, I was startled by my first glimpse of the employees' workroom. As it turns out, librarians read the People magazines before they go on display, and complain to each other about bratty kids that file through, and they leave sticky bottles of Mountain Dew in the refrigerator. Such are the secret lives of the people who used to strike fear into the hearts of my second-grade classmates. For me, it was a slightly jarring introduction to the working world. I was starting my first summer job, and, after hours, reading Blue Highways and thinking about journeys. William Least Heat Moon crossed the country over fifteen years ago, devouring Walt Whitman and "gathering the minds of men" (410). I was crossing a small threshold of reality, gathering observations on the behavior of men. He turned his back on the trials of life and I was watching its eccentricities; he was growing cynical and I am still completely green. Yet to me in June 1999, our journeys seemed almost identical. So as Least Heat Moon studied Leaves of Grass, I studied this road diary and tried to follow its winding philosophy. It was the philosophy that came in handy - especially the parts that Least Heat Moon picked up on his way... ...ye party. Marty made his specialty (Mountain Dew bundt cake). Millie smiled maternally and told the college students to be careful and call their mothers often. On her last day, Molly drove away blaring her horn and flashing her lights in exhilaration. As for me (like Whitman, a mere witness), I was wondering if these people were really who I saw them to be, and if they would be a part of me because of the time we spent together. An old Jerseyman to William Least Heat Moon, explaining his faith in the force of nature and in mankind: "...then say I believe... because it is absurd" (392). It is, indeed, absurd. And so I too believe. Works Cited Heat Moon, William Least. Blue Highways : A Journey into America. Boston: Little, Brown, 1982. Whitman, Walt. Leaves of Grass. Philadelphia, 1900.

Deaf Event Report Essay

About two weeks ago, I had the opportunity of attending a deaf event which was about deaf jewish life in Germany and Eastern Europe in the 1940’s and the Holocaust at California State University Northridge. This event was a great experience and really interesting to know. Not only was it a personal experience from the life of this speaker Mark Zaurov, but it was something to acknowledge within ourselves to learn how other culture express their emotions towards certain aspects they have been through in their daily lives. The presentation discussed the importance of establishing memorial Deaf for Jews. In this discussion Mark Zaurov included the term â€Å"Deaf Holocaust† which meant surviving struggles and hardships facing Jewish deaf during the Holocaust. Through many experiences and crucial humiliations by German Nazis. He then began to talk about the issues that were occurring with Aktion T4 and Forced Sterilization, which are often used general for research or exhibitions about Deaf people in the Holocaust. Despite what Mark Zaurov went through I learned that he was born deaf in Moscow, Russia. Together with his parents and his deaf sister, he emigrated to Israel.

Planning a Scheme of Work

Planning Scheme of Work – Literacy Level 2 The produced scheme of work is aimed at 16 to 18 year old learners who are enrolled on the â€Å"Entry to Employment† (â€Å"E2E†) programme. The programme is intended for unemployed young adults to assist them in improving their prospects of employment with training or of entering higher education. The programme is designed to include personal and social skills, vocational skills and Basic and Key Skills. In this context, much learning is intended to embed Basic and Key Skills into other areas of learning and vice-versa Session ContentSessions are based on the Skills for Life Teacher Resource Pack issued by the DfES, which is produced to support National Standards for Adult Literacy. These resources are designed to be based on real life situations, aimed at adults and to cover the Adult Literacy Core Curriculum. Six modules have been used, one at level one and five at level two. I have divided each module over two sessi ons each lasting for two hours of classroom time. Opportunities to complete tasks beyond the scope of the session are available as all learners have free study periods, which are supported by tutors.Extension activities using spelling and grammar exercises have been included and would also be completed in free study time. I have decided on the sequence of topics based on Reece & Walker (2003, p239) suggesting that easiest topics could be tackled first, so starting the programme with level 1 activities. I have also taken sessions directly relevant to E2E learners, i. e. job search, and used these for the first few sessions as I have observed this type of learner questioning the relevance of various activities they are asked to undertake on the wider E2E programme.Teaching and Learning Methods Sessions are started with a directed section, explaining objectives to the learners, using visual aids (interactive whiteboard and data projector) and or audio clips to demonstrate the learning point of the session and stimulate interest in the topic. This part of the session lasts about 10 to 15 minutes and is followed by an opportunity for learners to work on their own, in small groups or more usually in pairs, using printed or on-line resources, for around 40 to 50 minutes. During this time learners are supported by the tutor.After this a break is taken and the above process is repeated after break, focusing on the next part of the session, again starting with visual aids, usually in the form of a data projector. The final 10 minutes are used to re-iterate points made and check understanding through questioning. The scheme of work relies on the use of visual and audio stimuli in conjunction with individual learning as many learners on the E2E programme have had poor experiences of conventional classroom technique. A. T. Graham (1999, P. 26) Says:It is interesting to note the following figures for what we remember (learn? ) from our various senses: Sight 75% Hearing 13% Feeling 6% Smell 3% Taste 3% Feedback from learners of these methods is almost unanimously positive, especially towards the use of technology and visual aids. Assessment Methods At the end of each session, learners are encouraged to complete the module checklist and detail areas that they feel confident with or need more practice with. Each session incorporates tasks to be completed during the session and completion of the tasks is supported and observed by the tutor.This presents the opportunity to continually assess each student’s progress as well as assist any student encountering difficulty. Although not part of the scheme of work, students sit diagnostic assessments at the start of the programme and further diagnostics as well as practice tests later in the programme. Usually a second diagnostic at six weeks followed by mock tests at 10 and 12 weeks. Self Evaluation A self-evaluation form has been included for completion at the end of each session. The form examines the effectiveness of tutor and learner activities, resources and where relevant, achievement.The largest space is reserved for learner feedback as learners are asked for feedback after each session and asked to complete feedback forms on a regular basis. These, together with improvements in diagnostic and mock test scores form the basis of evaluation for this programme. Learning Theory & Motivation A key element of the scheme is that it encourages independent learning. Within each structured session there are opportunities for the learners to work on their own or in pairs with support from a tutor.During this time learners are not simply given worksheets and expected to complete them, each learner has access to their own resources which they follow at their own pace and work through with discussion between groups of learners and the tutor. So, for example, during a session on newspaper articles, after a class discussion of two examples of newspaper articles students would be asked to fi nd their own examples on the Internet, examine the differences between articles themselves and discuss their findings with the tutor one to one or in a small group.In this way learners take control of their own learning and experience the satisfaction of knowing that they are not simply filling in blanks. Learners on the E2E programme then have equal time in non-structured sessions to carry on with any unfinished work, carry out their own research and complete any extension activities. Geoffrey Petty (2001, P. 306) States that: There is a consensus amongst management theorists that giving employees control over how they work greatly increases their sense of responsibility, motivation and effectiveness.Unsurprisingly, giving students control over their own learning empowers them in the same way. Independence is not an arbitrary foundation for a teaching method: it resonates with a deep human need – the need for freedom; the need to be in control. This is a need felt most stron gly by adolescents†¦ 16 to 18 year old learners, many of whom have achieved little or nothing at school respond well to being given control of their own learning. ResourcesThe E2E programme benefits from being well resourced, especially with technology. This has an impact on the engagement of learners, most 16 to 18 year olds being unimpressed with anything less than cutting edge technology. Every learner has access to a broadband enabled, high specification computer on which to complete individual work, all resources are available across the network for printing and or editing by the learner, meaning that the learner is in control of his or her own version of the Skills for Life Resource Pack.So, for example, in lesson five, a resource page for searching the Internet would be projected to the whiteboard, we would be able to discuss the question â€Å"can you name any more search engines? † and the tutor would be able to note some examples on the screen for learners to s ee. Learners would then be able to look at their own version of this resource page, type in their answers and print off a hard copy for their file. They would then be able to access the Internet and continue with the activity. Equality of OpportunityAs discussed, the scheme of work is based around the Skills for Life Teacher Resource Pack issued by the DfES, the introduction to which states that the materials are intended to be â€Å"broad-based† and â€Å"adult-appropriate†. Within the materials, names, voices and pictures of characters are ethnically diverse and represent both genders. It is however the job of the tutor to be sensitive to learners and I have replaced 2 articles on terror alerts in lesson nine after awkwardness during the session amongst Muslim students.Wheelchair access to the building and wireless laptop computers are available to students with disabilities. Two of the fixed computers in the classroom are configured for large fonts. Conclusion The E ntry to Employment programme is aimed at a group of learners who have previously struggled in education and so challenge tutors to find new ways to engage them. Independent learning is encouraged by the Learning and Skills Council for E2E and more sources than that quoted support this method. The use of I. C. T. s also encouraged and this scheme of work relies heavily on it although a much less â€Å"high tech† version could be delivered if this was required. Although many learners are engaged by the technology, it cannot take the place of a tutor or teacher, merely add to the learning experience and a good understanding of the subject is impossible to replace. Bibliography A. T. Graham (1999) Planning for Teaching & Learning, Resource Handbook Geoffrey Petty (2001) Teaching Today, Cheltenham: Nelson Thornes Ltd Reece & Walker (2003) Teaching, Training and Learning ,Sunderland: Business Education Publishers Ltd.